Introduction

Meat is the primary source of animal protein for a variety of consumers, leading to a global increase in the demand for red meat consumption (FAO/WHO, 2014). As a result, abattoirs play a crucial role in managing and controlling various zoonotic infections, including Sarcocystis, a parasite responsible for foodborne illnesses that humans can contract by consuming undercooked or raw meat (Albayati et al., 2023). Sarcocystis species, typical intracellular coccidian foodborne parasites of the phylum Apicomplexa, undergo a required two-host life cycle, with sexual development in the intestinal tract of the definitive host and aural growth in many tissues of the intermediate host (Elshahawy et al., 2022). Cysts of this species are detected in the hearts, esophagus, diaphragms, tongues, masseter muscles, and other skeletal muscles of herbivores, their intermediate hosts, following multiple growth phases (Oğuz et al., 2020).

Many types of Sarcocystis species, including S. cruzi (which needs canids as its main host), S. bovifelis, S. bovini, and S. hirsuta (which need felids as their main host), S. hominis, and S. heydorni (which need humans as their main host), and S. bovini and S. sigmoideus (the definitive hosts are unknown), use cattle as their main intermediate host (Gjerde, 2016; Gupta et al., 2024). Sarcocystosis commonly causes eosinophilic myositis and myocarditis in bovines, leading to financial losses due to reduced milk production, miscarriages, and newborn deaths (Elshahawy et al., 2022). Similarly, human sarcocystosis can manifest in two distinct forms as a result of the ingestion of raw and/or inadequately cooked beef. The most well-known form is intestinal sarcocystosis caused by zoonotic species, which results in symptomatic stomach disruption (Dubey, 2015). The second case includes muscular involvement, which occurs when humans become accidental hosts as a result of the consumption of contaminated food by livestock Sarcocystis spp. fecal sporocyst stage (Murata et al., 2018). Sarcocystis secretory toxins have recently elevated the importance of this issue (Ota et al., 2019).

Concerns about meat-borne parasites are growing for several reasons, including the increasing consumption of raw and/or lightly cooked foods, which may increase exposure to parasites, and the growing importation of food, some of which comes from countries lacking advanced hygiene standards and testing procedures (CDC, 2000). Sarcocystosis in meat significantly diminishes the quality, and a high meat rating renders meat and offal unpalatable to consumers. Sarcocystosis is one of the zoonotic foodborne diseases that affect both humans and animals, in addition to the substantial financial losses that result from the condemnation of carcasses and/or offal in slaughterhouses. Sarcocystis infections in intermediate hosts are frequently asymptomatic, but serious cases have been reported, causing weariness, lack of appetite, diarrhea, weight loss, muscular convulsions, and, in extreme cases, death. Muscle tissue cysts containing bradyzoites distinguish sarcocystosis, a degenerative change in the intermediate host (Albayati et al., 2023).

This research aims to investigate the incidence of Sarcocystis infection in cattle and buffalo, which are strategically valuable and economically significant animals slaughtered at various central abattoirs in Aswan Governorate, Egypt, through macroscopic and microscopic investigation, as well as molecular recognition of Sarcocystis spp. by PCR-RFLP of the 18S rRNA gene to reduce the zoonotic risk posed by this parasite.

Materials and Methods

Research period and area

A cross-sectional investigation was conducted in Aswan, which is located in southern Egypt and experiences the warmest, hottest summers. Its 62,726 km² region is bounded by latitude 24° 5' 20.18" N and longitude 32° 53' 59.39" E. To ascertain the occurrence of Sarcocystis spp. and their monetary effect on slaughtered bovines (cattle and buffalo), the present retrospective analysis was carried out in several different abattoirs in Aswan Province, Egypt, between April and October 2024. The chosen abattoirs were the central slaughterhouses selected for their high annual animal throughput and varied geographic locations for the cattle. We reasoned that samples from these abattoirs would provide a thorough understanding of the prevalence of sarcocystosis in the research region because they receive slaughtered animals from different places. A comprehensive antemortem clinical assessment and postmortem investigation were performed on the slaughtered animals. Daily records for animals designated for slaughter were obtained from the general veterinary services’ archives.

Sample size

Thrusfield (2017) computed the sample size using a 95% confidence interval (CI) and 5% absolute precision. Thus, Elshahawy et al. (2022) calculated the anticipated prevalence of Sarcocystis spp. to be 92.5%.

n = requisite sample size, Z = appropriate percentage for the standard deviation for the expected confidence = 1.96, P_exp = predictable occurrence, and d = anticipated absolute accuracy (usually 0.05).

In contrast, 750 samples from cattle and buffaloes were inspected for the occurrence of Sarcocystis spp., with the larger sample size boosting the likelihood of discovering positive cases.

Study animals

According to the legal requirements of Egyptian abattoirs, routine daily antemortem and postmortem inspections examined about 750 slaughtered bovines of various ages and sexes, consisting of 375 cattle (237 male and 138 female) and 375 buffaloes (158 male and 217 female). Animal ages were determined by dental eruptions and categorized as <2 years (young), 2–5 years (adult), and >5 years (old).

Antemortem and postmortem checkup

Every animal underwent a physical clinical checkup before slaughter, adhering to the antemortem assessment protocols under the Egyptian Guidelines for Cattle Inspection under Law 517 (GOVS, 1986). Specifically, superficial lymph nodes, visible mucous membranes, and body condition were examined. The postmortem assessment for Sarcocystis spp. was carried out under Egyptian regulations (GOVS, 1986). The gross inspection involved slicing muscle masses from the esophagus, heart, tongue, masseter muscles, and skeletal muscles, which were meticulously examined and palpated with the naked eye for the detection of macroscopic sarcocysts. Upon the detection of a cyst, the sample was regarded as positive macroscopically; otherwise, it was subjected to microscopic analysis using the digestion method.

Samples collection

From each apparently Sarcocystis-free carcass, samples (75 g) were collected from the esophagus, heart, tongue, diaphragm, masseter muscles, and skeletal muscles of the fore and hind quarters to detect the incidence of microscopic bradyzoites. All samples were labeled, transported to Aswan University, Faculty of Veterinary Medicine, Food Hygiene Laboratory, and stored at 4°C until analysis.

Microscopy identification of Sarcocystis bradyzoites

Oguz et al. (2021) employed the pepsin digestion method for the identification of microcysts. In summary, 5 g of samples were placed in a 50 cc trypsin solution (1.3 g pepsin, 3.5 ml 25% HCl, 2.5 g NaCl, and 500 ml distilled water), thawed, and chopped for 30 minutes at 40 °C, and then homogenized using a tissue homogenizer. The filtrate was placed into a tube after the broken-down content was passed through a smooth mesh filter. Before processing each tissue, the homogenizer was washed with boiling water. The filtrate was centrifuged for ten minutes at 3500 rpm. A small amount of sediment at the bottom was then removed using a pipette, stained with Giemsa staining, and morphologically analyzed for Sarcocystis bradyzoites using a light microscope (x40).

Histopathological inspection

Tissue samples from positive microcyst samples were preserved in 10% neutral buffered formalin, dried in a series of graded alcohols, cleaned in xylene, embedded in paraffin, cut into 5 µm thick sections, and then placed on slides (Elbarbary et al., 2024). The samples were subsequently stained with hematoxylin and eosin and observed under a microscope. Highly qualified staff members from the Pathology Department, Faculty of Veterinary Medicine, New Valley University, thoroughly inspected every slide for microscopic Sarcocystis. The results were captured and documented using a Canon digital camera (Canon Powershot A95) attached to a Leitz Dialux 20 Microscope (Germany).

Sarcocystis species DNA identification

Getting DNA out

The Quick-gDNA™ MiniPrep reagent (Catalog No. D3024, Zymoresearch, USA) was used to extract DNA from microscopically positive samples from each category and preserved at -20°C until PCR analysis (Khairy et al., 2024).

PCR amplification

PCR was used to identify the 18S rRNA gene of Sarcocystis species specific for cattle and buffalo using the primers (Willowfort Company, United Kingdom), sarF-5'CGTGGTAATTCTATGGCTAATACA'3 and sarR-5'TTTATGGTTAAGACTACGGGTA'3, at 900 bp (Hooshyar et al., 2017). Each 25 µL PCR reaction included 5 μL of genomic DNA (~25 ng) and 1 μL of each primer at a 20 pmol concentration, mixed with 12.5 µL of EmeraldAmp Max PCR Master Mix (Takara, Japan) and 5.5 µL of nuclease-free water. Denaturation was performed at 94 ºC for 5 min, followed by 35 cycles of 94 ºC for 45 sec, 57.5 ºC for 45 sec (annealing), and 72 ºC for 60 sec (extension), with a final extension at 72 ºC for 5 min. Extracted DNA samples were electrophoresed in a 1.5% agarose solution in 1x TBE electrophoresis buffer at 80 V for 100 min; the gel was stained with ethidium bromide and then photographed on a UV transilluminator. The fragment sizes at 900 bp were confirmed using a 100 bp plus DNA ladder (Qiagen, Germany, GmbH).

Restriction fragment length polymorphism (RFLP)

To differentiate distinct Sarcocystis species, PCR products were digested with the restriction endonucleases Bsl1 and Ssp1 (FastDigest, Thermo Scientific) according to Jehle et al. (2009) and Hamidinejat et al. (2015). With the Bsl1 enzyme, the specific fragment sizes of RFLP digestion produce 343 and 513 bp for S. cruzi, 110, 242, and 525 bp for S. buffalonis, and 335 and 532 bp for S. fusiformis. Ssp1 enzyme-assisted RFLP digestion yields 260 and 647 bp for S. hirsuta and 233 and 637 bp for S. hominis. In a 50 µL reaction volume, PCR products were directly subjected to RFLP analysis, which included 5 µL of reaction buffer and 1 µL (10 U/µL) of restriction enzyme (Ssp1 and BclI) combined with 10–20 µL of PCR product. The restricted mixture was incubated for 16 hours at either 37 ºC (Ssp1) or 55 ºC (Bsl1). As directed by the manufacturer, enzymes were inactivated for 20 min at 65 ºC (Ssp1) and 80 ºC (Bsl1). After separation on 2% agarose gels and staining with ethidium bromide, the resulting restriction fragments were examined under ultraviolet light. A 100 bp DNA ladder was used as a scale marker.

Analyzing data

Microsoft Excel was used for the computations, and SAS (2004) Version 5 was used to apply the chi-square test to determine statistical significance. Branger (2013) discussed the analytic and prognostic utilities of microscopic examination.

Results

Incidence of Sarcocystis spp. in inspected carcasses and related major risk factors

Table 1 displays the characteristics of animals with suspicious Sarcocystis found during postmortem investigations; out of 750 examined slaughtered cattle and buffaloes, 20.5% (77/375) and 38.4% (144/375), respectively, were found to have macroscopic sarcocyst lesions, while the infection with microscopic sarcocyst was 30.4% (114/375) and 70.1% (263/375), respectively. Additionally, the findings showed that older cattle and buffaloes had a greater prevalence of macroscopic sarcocyst (41.5% and 52.3%) and microscopic sarcocyst (51.5% and 83.5%) than younger ones. According to the current findings, the young calf carcasses did not appear to have any apparent cyst infections. Both macroscopic cysts (29% and 51.6%) and microscopic cysts (52.2% and 88%) were highly prevalent in female cattle and buffaloes, respectively. Also, the majority of the bovine carcasses positive for Sarcocystis were discovered at the Aswan and Kom Ombo slaughterhouses. The age and sex of the slaughtered animals were found to be significantly linked to the occurrence of Sarcocystis (p ≤ 0.05).

Distribution of Sarcocystis spp. in different tissues

Localized sarcocyst lesions, mostly restricted to one or a few organs, were present in the majority of positive carcasses (Table 2). Macroscopic cysts were found more frequently in cattle and buffalo tissues, including the esophagus (19.5% and 36.5%), heart (15.5% and 25.9%), tongue (19% and 33.9%), diaphragm (17.6% and 35%), masseter muscles (16.5% and 32.2%), forequarters (13% and 22.6%), and hindquarters (10.4% and 17.9%), respectively. Microscopic cysts were found in the following tissues in cattle and buffalo: esophagus (28.5% and 66.4%), heart (23.5% and 46.7%), tongue (26.1% and 59.5%), diaphragm (27.5% and 63.5%), masseter muscles (27.2% and 62.1%), forequarters (19.2% and 31.7%), and hindquarters (18.1% and 23.7%), respectively.

Morphological identification of isolated macroscopic Sarcocystis

The macroscopic sarcocysts cysts that have been found can be fusiform, oval, spindle, elongated, cucumber, or rice-seed shaped and consist of opaque bodies that are milky white in color, located between muscle bundles along the longitudinal axis of the muscle mass. Macrocysts were found in various organs, either just beneath the serosal surface, as in the esophagus, or deep within the muscular layer, as in the diaphragm, tongue, and masseter muscles (Figures 1 and 2).

Figure 1. Macroscopic appearance of sarcocysts (indicated by black arrows) in different tissues of cattle carcass: esophagus (A), tongue (B), skeletal muscles (C), heart (D), diaphragm (E), and masseter muscles (F).

Figure 2. Macroscopic appearance of sarcocysts (indicated by black arrows) in different tissues of buffalo carcass: esophagus (A), tongue (B), skeletal muscles (C), heart (D), diaphragm (E), and masseter muscles (F).

Histopathological findings

The recovered microcysts were mostly fusiform, with an oval shape. The cell wall was thin and smooth, with a granular layer immediately underneath. There were septa that extended from the granular layer, splitting the cysts into sections with many banana-shaped bradyzoites inside. The histopathological analysis revealed that deteriorated cysts were located in areas of tissue necrosis. Additionally, there was an absence of an inflammatory response in the majority of the examined slides, and, to some extent, there was inflammation surrounding the muscle fibers and among the cysts, where neutrophils, lymphocytes, eosinophils, and plasma cells were present (Figure 3).

Figure 3. Histopathological observation of sarcocysts in different tissues stained with H&E stain. Encapsulated, circular to elongated basophilic sarcocysts filled with numerous bradyzoites, inserted into muscle fibers (indicated by black arrow) (A,C). B: large fusiform shaped, thin-walled, banana-like bradyzoites.

PCR-RFLP findings

The PCR investigation of all microsarcocyst samples indicated that 89 (78.1%) out of 114 cattle carcasses and 217 (82.5%) out of 263 buffalo carcasses had positive diagnostic bands at 900 bp on gel electrophoresis, demonstrating the occurrence of the Sarcocystis spp. 18S rRNA gene (Figures 4). On the other hand, Figures 5 & 6 display gel electrophoresis of the PCR–RFLP by amplification of the 18S rRNA gene from all positive isolates of microsarcocysts by PCR, revealing a unique fragment pattern for Sarcocystis spp. with the restriction endonucleases Ssp1 enzyme (S. hominis, S. hirsuta) and Bsl1 enzyme (S. cruzi, S. buffalonis, S. fusiformis).

Figure 4. Agarose gel showing PCR amplification pattern for the 18S rRNA gene of Sarcocystis spp. from examined cattle (lane 1 to lane 10) and buffalo (lane 11 to lane 20) at 900 bp. CN: control negative, CP: control positive, M= Marker (100 bp).

Figure 5. Identification of Sarcocystis spp. in slaughtered food animals using PCR–RFLP.

Figure 6. PCR–RFLP analysis of PCR products of the 18S rRNA gene of Sarcocystis spp. digested by the Ssp1 enzyme, resulting in 233 and 637 bp for S. hominis (Lanes 1&2 and 11&12), 260 and 647 bp for S. hirsuta (Lanes 3&4 and 13&14), and by the Bsl1 enzyme, resulting in 110, 242, and 525 bp for S. buffalonis (Lanes 5&6 and 15&16), 335 and 532 bp for S. fusiformis (Lanes 7&8 and 17&18), and 343 and 513 bp for S. cruzi (Lanes 9&10 and 19&20) from examined cattle and buffalo, respectively.

Discussion

Sarcocystis, an intracellular protozoan that infects a diverse array of vertebrates, livestock, and humans, is a parasite that contributes to the development of food-borne diseases (Hussein et al., 2023). This makes food safety measures crucial. Additionally, Sarcocystis is considered one of the primary contributors to economic losses in the livestock industry and may result in health issues for consumers. As part of the meat assessment procedure, split carcasses, organs, and lymph nodes are checked to ensure they are safe for human consumption and to collect global epidemiological information about zoonotic and parasitic infections like Sarcocystis (Lawan et al., 2020). The Egyptian General Organization of Veterinary Services employs visual, palpation, and incision assessments to conduct slaughterhouse monitoring to identify the presence of disease in slaughtered animals for consumption (Khairy et al., 2024).

Visual evaluation of muscle tissues in this study revealed macroscopic cysts as elongated, ovoid, and cigar-shaped, with rounded tips. A thorough postmortem investigation revealed a total rate of 20.5% and 38.4% macroscopic cysts and 30.4% and 70.1% microscopic cysts among slaughtered cattle and buffaloes, respectively. However, the incidence of Sarcocystis differs among the analyzed abattoirs. The Aswan and Kom Ombo abattoirs show a statistically significant greater frequency than others in the studied area, implying a highly contaminated environment. A thorough postmortem investigation revealed a total frequency of 20.5% and 38.4% macroscopic cysts and 30.4% and 70.1% microscopic sarcocyst in slaughtered cattle and buffaloes in this study, respectively. Nonetheless, the incidence of Sarcocystis differs among the analyzed abattoirs (p ≤ 0.05). The Aswan and Kom Ombo abattoirs show a statistically significant greater frequency than others in the studied area, implying a highly contaminated environment. The high infection rate in this investigation might be because the survival and viability of sporocysts in the environment are affected by seasonal changes in the infection, which are influenced by climate conditions like high temperature and humidity that characterize the studied area (Elshahawy et al., 2022).

Additionally, bovines are commonly susceptible to infection due to their frequent breeding in regions where stray canines and cats are present or environmental pollution caused by infectious species (El-Sayad et al., 2023).

Previous indigenous investigations revealed a wide range of infection rates in various Egyptian provinces: 7.5% in the New Valley city (Ahmed et al., 2016), 26.5% in Tanta (El-Sayad et al., 2023), 28% in Sohag (Khalifa et al., 2008), 88% in Menoufia (Mousa et al., 2021), and 92.5% in Aswan (Elshahawy et al., 2022). Similarly, researchers worldwide have documented the highest peak occurrences between 91.0% and 100%, including Argentina (More et al., 2008), the Southwest of Iran (Hamidinejat et al., 2010), Southern Italy (Bucca et al., 2011), Karnataka, India (Dafedar et al., 2011), Italy (Chiesa et al., 2013), Yazd and Hungary (Hornok et al., 2015), Iran (Sarafraz et al., 2020), Belgium (Zeng et al., 2021), Iraq (Albayati et al., 2023), and Iran (Dalir et al., 2023). Variances can be attributable to sample size, examined organs, diagnostic procedures, and, most importantly, the existence of infectious stages in the environment. A high frequency of sarcocystosis is associated with close interaction between the final and intermediate hosts (Dong et al., 2018).

The current study found a statistically significant correlation between the age and sex of the animal and the frequency of infection in older female animals, specifically buffaloes. Earlier investigations in Egypt (El-Sayad et al., 2023; Elshahawy et al., 2022; Gareh et al., 2020; Mousa et al., 2021) and other countries (Fayer et al., 2015; Imre et al., 2019; Mounika et al., 2018; Zeng et al., 2021) have also found a steady increase in infection with age. The animal management organization in Egypt may be responsible for the low ratio of infected bulls, as the majority of bulls are confined to the fattening system and are slaughtered at approximately two years of age, while cows are reserved for extended periods for milk production (Elrais et al., 2022). The higher infection rate may be explained by the fact that every female infected in our study was older than five years, which corresponds to the age at which the legislation of the Egyptian Ministry of Agriculture (laws 53/1966 and 207/1980) compels female slaughter. The results did not match those of Mousa et al. (2021), who found that microscopic cysts were more common in bulls (92% vs. 84%) in Egypt; El-Kady et al. (2018) found that they were 76.2% more common in bulls than in cows (9.5%) in Qena, Egypt; and Obijiaku et al. (2013) found 40% in cows and 47.7% in bulls in Nigeria. In young cattle, microcysts were discovered, but no macroscopic cysts were seen. Shekarforoush et al. (2013) attribute the scarcity of macroscopic cysts to their feline origin and the unusual cattle-cat contact in the study area. Likewise, Elshahawy et al. (2022), Mousa et al. (2021), and Yang and Dong (2018) found no macroscopic Sarcocystis cysts in the investigated cattle.

According to the findings of the present investigation, there was a statistically significant connection between the percentage of infection and the tissues that were examined, with the esophagus being the organ most frequently infected. Visual inspection of organs showed that Sarcocystis macrocysts preferentially localized to the esophagus, followed by the tongue and diaphragm, while the hindquarter muscles had the fewest macrocysts. It appears that the esophagus was an earlier stop on Sarcocystis’ migration route. Accordingly, future studies on the occurrence of Sarcocystis in cattle should focus on the esophagus, as it may be more useful in recognizing the infection at an earlier stage. A previous study that tracked the esophagus as the organ most frequently affected supported this outcome (Ahmed et al., 2016; El-Sayad et al., 2023; Elshahawy et al., 2022; Elrais et al., 2022; JyothiSree et al., 2017; Mousa et al., 2021). In contrast, numerous countries, including Argentina (Moré et al., 2011), Italy (Bucca et al., 2011), Brazil (Ferreira et al., 2018), Iran (Shahraki et al., 2018), the Netherlands (Hoeve-Bakker et al., 2019), and Belgium (Zeng et al., 2021), have recorded high incidence rates in the hearts and diaphragms of cattle, respectively, ranging from 58% to 99.5%, indicating that the heart and diaphragm are target colonizing sites for Sarcocystis. In addition to the distinctions between the aforementioned organs and muscles, variations in detection and identification methods (such as morphological and molecular recognition) and the research populations (such as age, sex, and breed) can lead to differences in the occurrence rates reported in the studies.

Improvements in livestock diagnosis techniques are crucial (Fotouh et al., 2024). This study subjected cysts recovered from slaughtered carcasses to a variety of diagnostic techniques beyond visual assessment. In this respect, the process of digestion and histological examination was applied to investigate microscopic cysts. Microscopic analysis revealed microcysts within the tissues of several organs, including the esophagus, heart, tongue, diaphragm, masseter muscles, forequarters, and hindquarters. These findings were consistent with other studies conducted on different hosts, which found minute cysts in various bovine tissues (Elrais et al., 2022; El-Sayad et al., 2023; Zeng et al., 2021). While buffaloes serve as intermediate hosts for S. fusiformis and S. buffalonis, the primary species that infect cattle are S. cruzi, S. hominis, and S. hirsuta (Lindsay and Dubey, 2020). The thickness and form of the cyst wall are used to categorize Sarcocystis species (El-Sayad et al., 2023). Some species, like S. cruzi, have thin walls, while others, such as S. hominis and S. hirsuta, have thick walls (Elshahawy et al., 2022). The histopathological analysis of the animals under investigation revealed the presence of morphologically distinct Sarcocystis species, including thick-walled species that form macrocysts and microcysts with distinct chambers, as well as thin-walled species. Comparable results were published by Ayazian et al. (2020), Elshahawy et al. (2022), and Ibrahim et al. (2018). Additionally, the tissue surrounding the cysts showed no signs of inflammation. Protozoa are found in cysts inside muscle fibers, providing defense from host immunity—a theory that has been validated for many other parasites—thus explaining the apparent absence of an inflammatory response (Nance et al., 2012; Shosha et al., 2024). Our findings align with the fact that inflammatory cells are not commonly observed in tissues affected by Sarcocystis infection (Gareh et al., 2020; Italiano et al., 2014).

Molecular techniques that rely on the recognition of the 18S rRNA gene use genetic markers for the species-specific differentiation of Sarcocystis. These approaches do not amplify other host or environmental DNA, as previously reported (Hajimohammadi et al., 2014). Thus, in the current investigation, PCR amplification of the 18S rRNA gene confirmed infection with Sarcocystis spp. in 78.1% and 82.5% of the analyzed microcysts in cattle and buffalo carcasses, respectively. This highlights the need for molecular diagnostics to distinguish Sarcocystis spp. from other cyst-forming diseases. The 18S rRNA fragment is considered a suitable tool for distinguishing Sarcocystis spp. on a global scale (Elshahawy et al., 2022). In the current study, the identification of Sarcocystis species using PCR-RFLP amplification of the 18S rRNA gene with restriction endonuclease enzymes (Ssp1 and Bsl1) demonstrated that S. cruzi and S. hirsuta are the most frequently identified species in Sarcocystis spp. in the examined bovine carcasses, followed by S. hominis, S. buffalonis, and S. fusiformis. Previous research published by El-Sayad et al. (2023), Elshahawy et al. (2022), Mousa et al. (2021), Prakas et al. (2020), Portella et al. (2021), and Oğuz et al. (2021) supported these findings. This result suggests that dogs and cattle often interact on Egyptian farms, supporting the parasite life cycle (Ferreira et al., 2018). Infected carnivores are thought to shed Sarcocystis sporocysts into the environment in very high quantities. For many reasons, including high temperatures, these sporocysts can remain viable for extended periods. Pastoral cattle easily consume these contaminated feces, which then contribute to further environmental contamination (Oğuz et al., 2021).

However, the authors recognize a significant gap in the available information regarding zoonotic foodborne parasites, particularly sarcocystosis, which pose a serious threat to human health and major livestock species, especially bovines, in Upper Egypt. Additionally, this issue remains underexplored in the farming sector, particularly concerning the often undetected Sarcocystis. The limitations of this research include the fact that PCR-RFLP was applied only to the samples that tested positive microscopically, and the absence of DNA sequencing techniques or phylogenetic studies for molecular validation of Sarcocystis species following PCR-RFLP analysis. We recommend further research to determine the actual prevalence of sarcosporidiosis in other herbivores across various regions of Egypt.

Conclusion

The current investigation has highlighted a significant incidence of bovine Sarcocystis in slaughtered cattle and buffalo intended for human consumption in Aswan abattoirs, Egypt. The most commonly identified Sarcocystis species in the bovine carcasses examined were S. cruzi, S. hirsuta, S. hominis, S. buffalonis, and S. fusiformis. To ensure the accurate identification of suspected cysts, traditional morphological techniques should be combined with modern molecular diagnostic methods in slaughterhouses. To mitigate the spread of the parasite and its associated economic and zoonotic risks, it is crucial for farmers and veterinarians to implement strategies that disrupt the parasite’s life cycle. Further molecular and biochemical research is required to differentiate between Sarcocystis spp. recovered from various hosts in different geographical regions of Egypt.