IJFS Italian Journal of Food Science IJFS 1120-1770 Codon Publications IJFS-37-255 10.15586/ijfs.v37i3.3024 ORIGINAL ARTICLE Bacillus cereus in meat products: Prevalence, toxins profile, antibiogram profile, and antimicrobial activity of Apple cider vinegar Elbarbary Nady Khairy1 Rhouma Nasreddin R.2 Abdelhafeez Mostafa M.3 Almutairi Layla A.4 Al-Doaiss Amin A.5 Ahmed Ahmed Ezzat56 El-Hawary Sohaila Fathi7 Dandrawy Mohamed K.8 Bekhit Mounir M.9 Darwish Wageh S.10 Abdelhaseib Maha11 Food Hygiene and Control Department, Faculty of Veterinary Medicine, Aswan University, Aswan, Egypt; Biology Department, Faculty of Science, Misurata University, Misurata, Libya; Public Health Department, Faculty of Health Sciences, Alasmarya Islamic University, Libya; Department of Biology, College of Science, Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia; Department of Biology, College of Science, King Khalid University, Abha, Saudi Arabia; Prince Sultan Bin Abdelaziz for Environmental Research and Natural Resources Sustainability Center, King Khalid University, Abha, Saudi Arabia; Biology Department, Collage of Science, Jazan University, Jazan, Kingdom of Saudi Arabia; Food Hygiene and Control Department, Faculty of Veterinary Medicine, South Valley University, Qena, Egypt; Pharmaceutics Department, College of Pharmacy, King Saud University, Riyadh, Saudi Arabia; Food Hygiene, Safety, and Technology Department, Faculty of Veterinary Medicine, Zagazig University, Zagazig, Egypt; Food Hygiene, Safety and Technology Department, Faculty of Veterinary Medicine, Assiut University, Assiut, Egypt Corresponding Author: Nady Khairy Elbarbary, Food Hygiene and Control Department, Faculty of Veterinary -Medicine, Aswan University, Aswan 81528, Egypt, E-mail: nadykhairy@vet.aswu.edu.eg

Academic Editor: Prof. Mariella Calasso – (SIMTREA), University of Bari, Italy

 01 07 2025 2025 37 3 255 266 17022025 02042025 © 2025 Codon Publications 2025 This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International (CC BY-NC-SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/)

Bacillus cereus is a significant foodborne bacterium that is prevalent in a variety of dietary products. This study aimed to assess the contamination rate, enterotoxin genes, and antibacterial susceptibility of B. cereus detected in 20 samples each of minced beef, beef shawarma, beef burger, beef kofta, beef sausage, chicken shawarma, chicken kofta, chicken kabab, and chicken sausage that were acquired from a variety of markets in the Aswan Governorate, Egypt. In addition, the antimicrobial impact of Apple cider vinegar (ACV) on B. cereus was investigated. The highest B. cereus levels were found in beef kofta samples (2.44×103 ± 0.16×102 CFU/g), followed by beef burger (2.02×103 ± 0.18×102 CFU/g) and beef sausage (1.88×103 ± 0.12×102 CFU/g). On an average, 30% of the samples were contaminated with B. cereus. All of the putative isolates showed B. cereus DNA according to PCR findings of the gyrB gene. Most of the strains (16/54) had the hblA gene, which was substantially more abundant than hblC (7/54) and hblD (5/54). However, nheA was detected in 10/54 samples and was substantially more prevalent than nheB (5/54) and nheC (3/54). Of the strains, 10 out of 54 have cytK. By comparison, the cesB detection rate was just 6/54, indicating that emetic strains are less frequent in meat products than diarrhea strains. Most strains were resistant to ampicillin, cefoxitin, and colistin (100% each), while they were entirely sensitive to imipenem, nalidixic acid, and vancomycin, rendering them the most significant antibiotics. By the agar well diffusion technique, all concentrations of ACV (10%, 30%, 70%, and 100%) were confirmed to have significant inhibitory activities against B. cereus, suggesting that ACV could be employed as a natural antimicrobial preservative in meat products. Nevertheless, more research is necessary to find other traits of B. cereus in meat products and the actions of other natural antibacterials.

 Antimicrobial resistance Apple cider vinegar Bacillus cereus natural preservative toxigenic genes Introduction

Food safety is a pertinent issue globally that affects international trade and human health. Foodborne infections pose serious risks to consumer health and place a financial strain on healthcare systems around the world, making them a major global public health concern (El-Hawary et al., 2025). A wide range of microbial pathogens that contaminate different kinds of meat products are responsible for the millions of foodborne illnesses that are reported each year. Among these pathogens, Bacillus cereus has maintained its significance as a result of its association with foodborne outbreaks and the ability to cause serious illness (Foxcroft et al., 2024). B. cereus is a rod-shaped, aerobic, or facultatively anaerobic, gram-positive, motile, spore-forming bacterium that is common in nature and can also be found in food. Vegetative cells of B. cereus can live and replicate in a pH range of 5 to 10. They can also develop in a moderately broad variety of temperatures and are highly resistant to salting. Alternatively, spores are exceptionally resilient to a variety of extreme conditions, including chilling, drying, high temperatures, and gamma- and UV-irradiation. This enables B. cereus to persist on a variety of surfaces and in the environment (Tirloni et al., 2022).

B. cereus is capable of producing a variety of virulence influences and can infiltrate the gastrointestinal mucosa through digestion, resulting in diarrhea and vomiting (Song et al., 2019). Diarrhea is related to four distinct enterotoxins: hemolysin BL (HBL, encoded by hblA, hblC, and hblD), cytotoxin K (CytK, encoded by cytK), enterotoxin FM (EntFM, encoded by entFM), and nonhemolytic enterotoxin (NHE, encoded by nheA, nheB, and nheC). However, emesis, or vomiting, is related to a tiny, acid- and heat-stable toxin produced by cesB genes (Ehling-Schulz et al., 2015). Other than food-related illness, B. cereus is linked to severe sicknesses like pneumonia, endocarditis, osteomyelitis, endophthalmitis, and necrotizing fasciitis (Ikeda et al., 2015).

The public health relevance of B. cereus has already been established worldwide, but its specific survival capabilities and possible environmental adaptations may become more significant for food safety authorities and the food industry when considering our changing climate. B. cereus presents a substantial public health concern because of the quantity of meat products consumed in Egypt and the nature of their processing. A rise in its abundance in these foods increases the danger of exposure and the propagation of antibiotic-resistant bacteria. The significance of B. cereus for public health is highlighted by theories on its environmental and temperature range adaptability (Foxcroft et al., 2024). Antibiotics are still the best way to treat microbial illness, involving those produced by B. cereus. Conversely, the prevalent application of antibacterials has caused the development of antibacterial-resistant strains, linking strains that are resistant to more than one antibiotic (Friedman et al., 2016). Thus, it is imperative to discover the profile of antibiotic resistance of B. cereus to select the appropriate medications for therapy schemes.

Numerous investigations have been carried out to find novel techniques to prolong the duration of protection of meat and its products without using chemical supplements, as there is growing concern about the present developments regarding applying different common substitutes to improve the duration of keeping meat and its products safe and improve its shelf life. This is particularly relevant given the substantial rise in the manufacturing of meat products and their role in supplying the desired flavor and taste (Nady et al., 2024).

Apple cider vinegar (ACV) is an organic by-product of apple fermentation, consisting of apple, sugar, and yeast. It shows antibacterial efficacy against gram-positive microbes. Chemicals in plants, such as organic acids, minerals, flavonoids, vitamins, and polyphenols, work together to fight bacteria and other harmful substances (Mahmoud et al., 2024). The long-term tracking and trending of B. cereus in meat products can provide information on any significant changes in their prevalence, including specific food types. Such information could provide an early indication of changing factors in the environment, food chain, and food handling, and potentially impact food safety practices and standards. This research looked into the incidence, enterotoxin genes, and antibacterial resistance patterns of B. cereus strains in some meat products in Aswan, Egypt, as well as the effectiveness of ACV as a natural preservative against B. cereus.

 Materials and methods <italic>Samples</italic>

Between March and May 2023, 180 meat product -samples—20 samples each of minced beef, beef shawarma, beef burger, beef kofta, beef sausage, chicken shawarma, chicken kofta, and chicken kabab—were -collected from retail markets in the Aswan Governorate, Egypt. Every sample was stored under 4°C after being transferred to the lab from separate sterile bags in an icebox.

 <italic>Enumeration, isolation, and identification of B. cereus</italic>

Every sample (25 g) was mixed with peptone water 0.1% (225 mL) (Oxoid, CM0009B) to make sequential dilutions and homogenized in a stomacher (Seward®400) (ISO 21871, 2006). One milliliter of the initial dilution was then placed on Mannitol Egg Yolk-Polymyxin agar (MYP) (Oxoid, CM09) and incubated for 24 h at 30°C. The colony counter was used to enumerate the lecithinase activity of a typical B. cereus colony, which was pink in color and surrounded by a precipitation zone. Then, a single colony was spread on chromogenic B. cereus agar plates (Huankai). Based on Quinn et al. (2002), various apparent colonies on chromogenic B. cereus agar plates were selected and incubated for 24 h at 37°C for additional biochemical characterization (Gram stain, starch hydrolysis, catalase, nitrate reduction, Voges–Proskauer, citrate utilization, lysozyme resistance, and anaerobic fermentation of glucose). In addition, the recognition of parasporal protein toxin crystal and rhizoid proliferation were conducted (Tallent et al., 2012).

 <italic>PCR for detection of B. cereus toxins profile</italic>

GeneJET™ Genomic DNA Purification Kit (Thermo Fisher, K0722) assisted in extracting genomic DNA from the positively identified B. cereus culture, and the DNA is preserved at −20°C. After using gyrB gene primers to identify the B. cereus genotype, multiplex PCR was employed to recognize eight virulence factors (hblA, hblC, hblD, nheA, nheB, nheC, cytK, and cesB). The 25 μL PCR reaction consists of 12.5 μL COSMO PCR RED Master Mix, 1 μL each of reverse and forward primers (20 pmol), 6 μL DNA, and 4.5 μL free nuclease water. The amplification was conducted by the methods previously described (Ehling-Schulz et al., 2005; Hansen and Hendriksen, 2001; Tewari et al., 2015). Table 1 displays the thorough sequence of data used. The PCR product was analyzed by gel electrophoresis in a 1% agarose stained with SYBR SAFE (0.6 g/100 mL) at 100 V for 30 m (Elbarbary et al., 2024) and captured using a UV LED (BioRad).

Oligonucleotide primer sequences used for PCR.

Primer Primer sequence 5'- 3' Annealing temp (°C) Amplicon size (bp) Reference
gyrB F- TCATGAAGAGCC TGTGTACGR- CGACGTGTCAATTC ACGCGC 63 475 Tewari et al. (2015)
HblA F- GTGCAGATGTTGATGCCGATR- ATGCCACTGCGTGGACATAT 55 320 Hansen and Hendriksen (2001)
HblC F- AATGGTCATCGGAACTCTATR- CTCGCTGTTCTGCTGTTAAT 55 750
HblD F- AATCAAGAGCTGTCACGAATR- CACCAATTGACCATGCTAAT 55 430
NheA F- TACGCTAAGGAGGGGCAR- GTTTTTATTGCTTCATCGGCT 55 500
NheB F- CTATCAGCACTTATGGCAGR- ACTCCTAGCGGTGTTCC 55 770
NheC F- CGGTAGTGATTGCTGGGR- CAGCATTCGTACTTGCCAA 55 583
cytK F- AAAATGTTTAGCATTATCCGCTGTR- ACCAGTTGTATTAATAACGGCAATC 55 238
cesB F- GGTGACACATTATCATATAAGGTGR- GTAAGCGAACCTGTCTGTAACAACA 53 1271 Ehling-Schulz et al. (2005)
<italic>Examining the antibiotic sensitivity of B. cereus strains</italic>

The Kirby–Bauer disk diffusion susceptibility technique, as described by Khairy et al. (2024), was employed to assess sensitivity to antimicrobials of all B. cereus isolates. Picked fresh isolate colonies were placed in 2 mL of sterile saline, combined, and then incubated at 37°C for 24 h. After that, the turbidity of the suspension was set by matching it to the 0.5 McFarland standard solution. On Muller-Hinton agar (MH) (Oxoid, CM0337), an immersed swab (HiMedia, PW009) from an inoculum tube was streaked three times. The antibacterial disks were put and distributed superficially on the MH agar with sterile forceps. After 24 h of incubation at 37°C, the inhibition area was finally assessed. The data were interpreted under Clinical Laboratory Standards Institute (CLSI 2017), and the strains were grouped as susceptible (S), intermediate (I), or resistant (R) following Magiorakos et al. (2012). Twenty antibiotics (Oxoid, UK) were tested, including ampicillin (AMP, 10 μg), quinupristin (QD, 15 mg), cefoxitin (FOX, 30 mg), cephalothin (kF, 30 μg), ciprofloxacin (CIP, 5 μg), cefotaxime (CTX, 30 µg), imipenem (IPM, 10 μg), vancomycin (VA, 30 μg), trimethoprim-sulfamethoxazole (SXT, 1.25 μg/23.75 μg), chloramphenicol (C, 30 mg), nalidixic acid (NL, 30 μg), clindamycin (DA, 2 μg), doxycycline (DO, 30 μg), erythromycin (E, 15 μg), colistin (CT, 10 μg), tetracycline (TE, 30 mg), gentamicin (CN, 10 mg), nitrofurantoin (FD, 300 mg), rifampicin (RA, 30 μg), and kanamycin (K, 30 mg). The antimicrobial agents that were analyzed are frequently employed in the veterinary and health sectors of Egypt. For each antibiotic and isolate, the multiple antimicrobial resistance (MAR) indices were assessed. A MAR rate of < 0.2 shows that the isolates developed from a polluted source with a low risk. On the other hand, isolates with a MAR > 0.2 have been from high-risk sources of pollution (Lozano et al., 2020).

 <italic>In vitro assessment of antibacterial action of ACV</italic>

The ACV utilized in this investigation was obtained from Bragg Co., USA, via Amazon. eg. It was organic raw ACV, unfiltered, 5% acidic, unpasteurized, unheated, and had the amazing mother of vinegar.

The antibacterial effect of ACV was assessed using the agar well-diffusion technique against B. cereus isolates, as earlier reported by Balouiri et al. (2016). Using 0.9% sterile saline solution, the suspension turbidity of purified bacterial culture (106 CFU/mL) was under 0.5 McFarland. Subsequently, a sterile cotton swab was employed for spreading 100 µL of the sample onto Mueller-Hinton agar (Hi-Media) plates. Using a sterilized cork borer, holes (7 mm) were created in the plates. These were then filled with 100 μL of produced ACV of 10%, 30%, 70%, and 100%, and incubated at 37°C for 24 h. A negative control was recognized by sterile demineralized water, although a positive control was established via antibiotic discs (ampicillin, 10 μg). The inhibitory halo diameter was measured using a gauge (mm). Assessments were taken in triplicate to establish the mean and standard deviations of the inhibition zone, which were determined. The strains were classified as resistant (0) for diameters < 8 mm, moderately sensitive (+) for 8–20 mm, sensitive (++) for 20–30 mm, and very sensitive (+++) for diameters >30 mm.

 <italic>Minimal inhibitory concentration (MIC) and minimal -bactericidal concentration (MBC) assessments</italic>

Following CLSI (2012) references, MIC and MBC were assessed via a standard broth microdilution procedure. Fresh Mueller-Hinton broth was employed to produce the bacterial suspensions for the experiment, with the concentration of bacteria adjusted to 106 CFU/mL. Twofold serial dilutions of ACV from the standard solution (1,016 μg/mL) were made in sterile distilled water. A volume of each ACV dilution (100 μL) was poured on U-shaped bottom, sterile polystyrene, 96-well culture plates (Techno Plastic Products, Switzerland). Every well got 100 µL of every bacterial suspension, kept at 37°C for 24 h. The MIC was found to be the smallest amount of antibacterial agent that completely stopped visual growth (CLSI, 2012). This means that there was no growth in the well that was related to the positive and negative growth wells. The MBC was recognized as the lowest dose that produced no observable growth following the incubation period (Andrews, 2001). The MBC was identified by subculturing 10 μL of the suspension from every well on MHA. The plates were subsequently left at 37°C for 24 h, or until growth was detected in the positive growth control. Every test was approved in triplicate, and the mean ± standard error of the mean was used to present the findings.

 <italic>Statistical analysis</italic>

All of the data were examined using GraphPad Prism 9.0 under one-way analysis of variance (ANOVA). Outcomes were presented as mean ± SEM with a significance value of p < 0.05.

 Results <italic>Occurrence of B. cereus</italic>

From Table 2, it is evident that the incidence of B. cereus counts in the studied samples was the highest in beef kofta samples (2.44×103 ± 0.16×102 CFU/g), followed by beef burger (2.02×103 ± 0.18×102 CFU/g) and beef sausage (1.88×103 ± 0.12×102 CFU/g), with no significant variations between them while there are significant differences observed between other samples. Chicken Kabab (0.17×102 ± 0.02×102 CFU/g) and chicken shawarma reported the lowest count (0.24×102 ± 0.01×102 CFU/g).

The mean values of Bacillus cereus count (CFU/g) in the examined samples (n = 20 each).

Sample Min Max Mean±SE
Minced beef 0.36×10 6.42×103 0.86×102±0.13×102b
Beef kofta 0.88×10 8.62×104 2.44×103±0.16×102a
Beef burger 0.67×10 7.58×104 2.02×103±0.18×102a
Beef shawarma 0.074×10 2.76×102 0.47×102±0.05×102c
Beef sausage 0.64×10 4.33×104 1.88×103±0.12×102a
Chicken shawarma 0.058×10 0.78×102 0.17×102±0.01×102c
Chicken kofta 0.48×10 5.63×102 1.52×102±0.11×102b
Chicken burger 0.73×10 7.48×103 1.72×102±0.16×102b
Chicken Kabab 0.033×10 0.43×102 0.24×102±0.02×102c

Data followed by different superscript letters (a–c) is significant at p < 0.05.

Of the 180 RTE samples evaluated, 54 (30%) samples have B. cereus. According to the findings, the incidence of B. cereus was 45% in beef kofta and beef burgers; 35% in minced beef, beef sausage, and chicken burgers; 25% in beef shawarma; and 10% in chicken shawarma and chicken kabab (Figure 1). B. cereus was recognized on special agar plates by their distinct wavy colony shapes. Standard B. cereus colonies appear pink in color and have a surrounding area that shows precipitation, which indicates lecithinase action, and they do not ferment mannitol (this shows a positive Nagler response). Tests showed that B. cereus samples had mobility and were able to use citrate, produce Voges-Proskauer, have catalase activity, ferment glucose, and break down gelatin. Similarly, the isolates were negative for oxidase, H2S generation, methyl red, and indole. The samples did not have any protein crystals from Bacillus thuringiensis after being stained with carbol fuchsin using the Ziehl–Neelsen method.

Prevalence of Bacillus cereus in the examined products. Data with different superscript letters (a–c) are significant at p < 0.05.

 <italic>Toxins profile of B. cereus by multiplex PCR</italic>

Following phenotypically suspicious isolates of B. cereus, PCR analysis—relying on the identification of a specific species—gyrB—was then performed. On agarose gel, all isolates generated 475 bp PCR products that were specifically B. cereus (Figure 2). The toxins’ profile established in this research using multiplex PCR and its distribution was assessed and categorized in Figure 3. The virulence genes of B. cereus are categorized into two groups based on their pathogenic properties: enterotoxin genes (hblA, hblC, hblD, nheA, nheB, nheC, and cytK) and cereulide synthetase genes (cesB). In hemolysin enterotoxin genes, the hblA gene occurs in most of the strains (16/54) and was considerably higher than hblC (7/54) and hblD (5/54). Nonhemolytic enterotoxin, nheA, was detected in 10/54 and was significantly higher than nheB (5/54) and nheC (3/54). Cytotoxin K (cytK) was detected in 10/54 of the strains. However, only 6 out of 54 samples tested positive for the cereulide synthetase gene (cesB), suggesting that emetic bacteria are less abundant in meat products compared to diarrheal ones (Figures 3 and 4). The incidence of toxigenic factors in the obtained strains showed statistically a notable variation (p < 0.05).

Electrophoretic profile of amplification products of the confirmed gyrB B. cereus gene at 475 bp. Lanes 1–7: minced beef, lanes 8–16: beef kofta, lanes 17–25: beef burger, lanes 26–30: beef shawarma, lanes 31–37: beef sausage, lanes 38–39: chicken shawarma, lanes 40–45: chicken kofta, lanes 46–52: chicken burger, and lanes 53–54: chicken Kabab. M: marker (50 bp), C+: positive control, C–: negative control.

Prevalence of virulence enterotoxin and emetic genes of Bacillus cereus isolates. There is a significant variance at p < 0.0001.

Electrophoretic profile of amplification products of enterotoxin and emetic genes in Bacillus cereus: hblA at 320 bp, hblC at 750bp, hblD at 430bp, nheA at 500 bp, nheB at 770 bp, nheC at 583bp, cytK at 238bp, and cesB at 1271bp. Lanes 1–7: minced beef, lanes 8–16: beef kofta, lanes 17–25: beef burger, lanes 26–30: beef shawarma, lanes 31–37: beef sausage, lanes 38–39: chicken shawarma, lanes 40–45: chicken kofta, lanes 46–52: chicken burger, and lanes 53–54: chicken Kabab. M: marker (50 bp), C+: positive control, C–: negative control.

 <italic>Antibiogram profile of B. cereus</italic>

Every B. cereus isolate underwent testing for antibacterial sensitivity to 20 chosen antibiotics. Tables 3 and 4 displayed that most of the isolates were resistant to ampicillin, cefoxitin, and colistin (100% each), while being completely susceptible to imipenem, nalidixic acid, and vancomycin, making them the most significant antibiotics. The B. cereus strain showed multidrug resistance (resistance to at least three types of antibiotics) between 0.15 and 0.85, with an average of 0.517. The investigated B. cereus strains showed statistically a notable variation in their sensitivity to different antibacterials (p < 0.05).

The interpretation of antimicrobial resistance of Bacillus cereus isolates (n = 54).

Antimicrobial agents Sensitive Intermediate Resistance
No. % No. % No. %
AMP 0 0 0 0 54 100
kF 7 13 0 0 47 87
QD 29 53.7 5 9.3 24 44.4
FOX 0 0 0 0 54 100
CTX 11 20.4 4 7.4 39 72.2
IPM 54 100 0 0 0 0
NL 54 100 0 0 0 0
CIP 23 42.6 6 11.1 25 46.3
SXT 7 13 7 13 40 74.1
DO 17 31.5 9 16.7 28 51.8
E 12 22.2 5 9.3 37 68.5
DA 41 76 0 0 13 24
VA 54 100 0 0 0 0
CT 0 0 0 0 45 100
TE 27 50 5 9.3 23 42.6
C 30 55.6 3 5.6 21 38.8
FD 31 57.4 7 13 16 29.6
RA 28 51.8 0 0 26 48.1
GN 36 66.7 11 20.4 7 13
K 42 77.8 0 0 12 7.6
p value p < 0.0014 p < 0.0001 p < 0.0001

AMP: ampicillin, kF: cephalothin, QD: quinupristin, FOX: cefoxitin, CTX: cefotaxime, IPM: imipenem, NL: nalidixic acid, CIP: ciprofloxacin, SXT: trimethoprim-sulfamethoxazole, DO: doxycycline, E: erythromycin, DA: clindamycin, VA: vancomycin, CT: colistin, TE: tetracycline, C: chloramphenicol, FD: nitrofurantoin, RA: rifampicin, GN: gentamicin, and K: kanamycin.

Antibiogram profile of Bacillus cereus isolates (n = 54).

Isolates No. Antimicrobial resistance profile No. of antibiotics MAR index
16 AMP, FOX, CT, kF, CTX, QD, CIP, SXT, DO, E, DA, C, TE, FD, RA, GN, K 17 0.85
13 AMP, FOX, CT, CTX, QD, E, CIP, DA, C, TE, FD, RA, GN, K 14 0.70
11 AMP, FOX, CT, CTX, kF, CIP, SXT, DO, E, DA, RA, K 12 0.60
8 AMP, FOX, CT, CTX, CIP, FD, RA, GN, K 9 0.45
4 AMP, FOX, CT, SXT, DO, TE, FD 7 0.35
2 AMP, FOX, CT, 3 0.15
54 MAR average 0.517

MAR: multiple antibiotic resistant, AMP: ampicillin, kF: cephalothin, QD: quinupristin, FOX: cefoxitin, CTX: cefotaxime, IPM: imipenem, NL: nalidixic acid, CIP: ciprofloxacin, SXT: trimethoprim-sulfamethoxazole, DO: doxycycline, E: erythromycin, DA: clindamycin, VA: vancomycin, CT: colistin, TE: tetracycline, C: chloramphenicol, FD: nitrofurantoin, RA: rifampicin, GN: gentamicin, and K: kanamycin.

 <italic>Antimicrobial action of ACV against B. cereus</italic>

By the agar well diffusion experiment, all ACV doses (10%, 30%, 70%, and 100%) confirmed substantial inhibitory influence against B. cereus isolates, as shown in Table 5. More research was done on the inhibition zone ranges (mm) of the several antibiotics employed in the current investigation at their concentrations. The inhibitory zone diameter was between 11.5±0.6 and 16.4±0.3 mm (10% ACV), 13.6±0.4 and 19.4±0.8 mm (30% ACV), 17.2±0.2 and 24.7±0.5 mm (70% ACV), and 19.8±0.6 and 31.6±0.8 mm (100% ACV). Using 15 B. cereus isolates, MIC and MBC were inevitably carried out to ascertain exactly the antibacterial qualities of ACV. The MIC data revealed that ACV had high antibacterial action contrary to the tested isolates, with MICs ranging from 0.14 to 1.25 mg/mL. In the context of the AVC as a bacteriocidal agent, certain isolates that were investigated exhibited an MBC rate similar to the MIC rate.

Inhibitory zone diameters, MIC, and MBC of ACV against Bacillus cereus isolates (n = 15).

Isolate no. Zone diameter (mm) against various ACV concentrations (%) MIC (mg/mL) MBC (mg/mL)
10 30 70 100
1 14.3±0.7 16.4±0.2 19.5±0.2 22.7±0.1 0.14 0.28
2 12.5±0.3 13.6±0.4 17.2±0.2 20.4±0.2 0.16 0.32
3 15.2±0.6 18.2±0.6 21.7±0.2 26.5±0.6 0.16 0.32
4 14.8±0.3 18.2±0.5 22.6±0.3 28.4±0.2 0.14 0.14
5 11.5±0.6 14.3±0.5 18.5±0.3 21.7±0.3 0.16 0.64
6 12.7±0.3 14.9±0.3 20.0 ±0.4 24.3±0.6 0.14 0.28
7 16.2±0.7 19.4±0.8 24.7±0.5 31.2±0.8 1.25 2.5
8 12.9±0.3 15.5±0.6 19.5±0.4 25.7±0.3 0.14 0.28
9 15.4±0.8 19.2±0.3 24.3±0.7 30.5±0.7 0.14 0.56
10 15.8±0.3 16.7±0.3 18.5±0.3 19.8±0.6 0.16 0.64
11 13.7±0.4 17.4±0.6 18.7±0.4 21.5±0.4 0.14 0.14
12 16.4±0.3 18.6±0.4 22.5±0.2 29.7±0.3 0.14 0.28
13 14.4±0.2 17.8±0.3 23.3±0.7 31.6±0.8 0.56 0.56
14 15.2±0.6 19.2±0.7 23.5±0.4 31.4±0.7 0.16 0.64
15 12.8±0.5 16.6±0.3 20.4±0.3 28.5±0.8 1.25 2.5

ACV: Apple cider vinegar, MIC: Minimal inhibitory concentration, MBC: minimal bactericidal concentration.

 Discussion

B. cereus is one of the most prevalent foodborne bacteria, causing serious food poisoning. The condition is primarily characterized by vomiting, diarrhea, liver failure, necrotic enteritis, and abdominal discomfort. Furthermore, B. cereus is commonly described to be the most common bacteria present in a variety of meat products. It is considered a public health concern (Algammal et al., 2024) following ingestion of a contaminated meal that has more than 104–105 B. cereus spores or vegetative cells/g (Gao et al., 2018). The study found that there was a potential danger of B. cereus, with counts ranging from 0.17×102 ± 0.02×102 in chicken kabab to 2.44×102 ± 0.16×102 in beef kofta. Alarmingly, B. cereus counts in certain of the investigated samples (beef kofta, beef burger, and beef sausage) surpassed the allowed limits (<103 CFU/g) indicated by the Health Protection Agency (2009) in England. Furthermore, Stenfors et al. (2008) verified that low B. cereus levels in food could cause major occurrences of food poisoning among consumers. In addition, the product is not appropriate for human consumption if the count of B. cereus exceeds 104 CFU/g or mL (FSANZ, 2001). In Hong Kong, ready-to-eat foods are sorted into three groups based on the amount of B. cereus they contain: satisfactory (<103 CFU/g), acceptable (103–105 CFU/g), and unsatisfactory (>105 CFU/g). It is illegal to sell “unsatisfactory” ready-to-eat foods (Centre for Food Safety, 2014). Therefore, regulations, directives, and decisions represent the main regulatory acts applicable to veterinary, sanitary, and food safety for the protection of consumers. All regulations are centered on the protection of the agro-alimentary line, food safety, and the protection of consumer interests. This is one of the main reasons why the involvement of civil society and consumers in debating and passing veterinary, sanitary, and food safety legislation, particularly food-related legislation, is increasingly obvious (Bondoc, 2016a, b).

Consequently, it is imperative to maintain appropriate temperature control, even throughout food preparation. Cold foodstuffs must be preserved at a temperature below 4°C, while hot foods must be preserved at a temperature above 60°C to prevent food with B. cereus (Mostafa et al., 2022). All of the isolates (30%) that were obtained for this study showed the distinctive phenotypic characteristics of B. cereus and showed agreement in their biochemical reactions. The higher occurrence of beef kofta and beef burgers compared to chicken kabab and chicken shawarma may be related to the preparation methods used for each type of meat and the inclusion of intestinal parts. In addition, adding spices and vegetables to meat may enhance the risk of B. cereus contamination and serve as another cause of contamination (Shawish and Al-Humam, 2016). Our findings matched those informed by Bashir et al. (2017), Tewari et al. (2015), and Yu et al. (2020), with respective percentages of 29.3%, 30.9%, and 35%. Higher ratios of B. cereus from meat products were noted by Abd El Tawab et al. (2015), Hwang and Park (2015), and Owusu-Kwarteng et al. (2017), who reported 38.3%, 47%, and 50.5%, respectively. Low percentages were recorded by Algammal et al. (2024), Amin and Tawfick (2021), Mahmoud et al. (2024), and Mostafa et al. (2022), who found B. cereus in 21%, 24%, 22.7%, and 11.1%, respectively, of the examined samples. In addition, common risk factors that contribute to the spread of B. cereus foodborne poisoning include ambient pollution, improper food temperature processing, and improper cleaning of food production equipment and preparation surfaces (Yu et al., 2020).

B. cereus has been linked to meat additives such as rice and flour that are used in the production of meat products (Giffel et al., 1996). Meat products were most likely contaminated during handling and preparation or after they had been processed. Furthermore, leaving the items out of the refrigerator for many hours promotes B. cereus proliferation and thus enterotoxin release (Shawish and Tarabees, 2017). Moreover, incorrect management of meat products next to cooking permits B. cereus spores to produce vegetative cells that grow and cause food poisoning (Hassan et al., 2019). Furthermore, additives, seasonings, and spices are added, which are regarded as a potential hazard since they increase the quantity of Bacillus spores and thus increase the chance of food illness (Shawish and Tarabees, 2017).

Molecular approaches are more precise for making conclusive identifications. As shown in Figures 2 and 3, the housekeeping gene gyrB of B. cereus, a molecular diagnostic marker, was positive in all detected phenotypic isolates of B. cereus. The public health significance of B. cereus strains as a reason for severe food illness in humans is highlighted by the fact that all of the strains obtained in this research inherited one or more enterotoxigenic genes. This matches the findings of Algammal et al. (2024), Amin and Tawfick, (2021), Fraccalvieri et al. (2022), Mahmoud et al. (2024), Owusu-Kwarteng et al. (2017), and Tewari et al. (2015). The pathogenicity is primarily supported by numerous virulence factors and toxins expressed by the appropriate genes. The consumption of B. cereus-polluted food causes illness. B. cereus cells adhere to the human intestinal mucosa, colonize, and produce enterotoxins (Algammal et al., 2024). The primary virulence determinants associated with food poisoning produced by B. cereus are the nheABC, hblABCD, cytK, and cesB genes (Berthold-Pluta et al., 2019). Many foodborne B. cereus outbreaks have been identified globally, and the sickness manifests in emetic and diarrheal forms. Cytotoxin K, a powerful heat-labile enterotoxin, is regarded as the primary virulence factor implicated in severe diarrhea, while emetic sickness is credited primarily to the cereulide toxin (ECDC, 2019). Furthermore, B. cereus has been linked to serious human diseases such as pneumonia, neonatal bacteremia, gas gangrene, bacterial meningitis, and ocular infections (Algammal et al., 2024).

Antibiotic therapy is the principal management for B. cereus infection. However, the failure of antibacterial treatment occurs from the development of antibacterial-resistant B. cereus strains, mostly from drug misuse or the gaining of resistance genes by horizontal gene transfer (Gao et al., 2018). Thus, the detection of the antibacterial resistance outline of B. cereus is of paramount importance to public well-being. In this investigation, imipenem, nalidixic acid, and vancomycin showed significant antibacterial activity against B. cereus strains from the various items tested. Furthermore, the retrieved strains were the consequence of high-risk contamination, as shown by the concerning MAR value of 0.517 (>0.2) (Qenawy et al., 2024). These outcomes coincide with those validated by Algammal et al. (2024) and Ikeda et al. (2015), who found that every acquired B. cereus strain was quite sensitive to vancomycin. In addition, the B. cereus isolates that were obtained were entirely resistant to ampicillin, cefoxitin, and colistin, and they exhibited exceptional resistance to almost all of the antibiotics that underwent testing, involving erythromycin, trimethoprim-sulfamethoxazole, doxycycline, and cefotaxime. Our results complement those emphasized by Mahmoud et al. (2024), Savić et al. (2016), and Yu et al. (2020). According to these findings, multidrug-resistant (MDR) B. cereus has been occurring in a diversity of meat products, indicating that it may be a major way for human consumers to contract foodborne MDR B. cereus (Bhunia, 2018). According to Algammal et al. (2024), the careless application of antibiotics in the medical and agricultural fields and the general public, as well as the ability to obtain medicines without a prescription and use them recklessly, promotes the emergence of MDR strains.

Various food preservation methods, particularly chemical antimicrobial agents, have long been applied industrially to stop the growth of bacteria in food products (Tropea, 2022), thereby improving the safety and extending the shelf life of the products. The scientific community and food companies have been motivated to look for efficient substitutes for the chemical antibacterial agents frequently employed in food preservation in recent years because of the growing understanding of the impact of diet on human well-being. Consumers are indeed skeptical of the use of these compounds, despite their stringent regulation, as a result of their potential long-term health risks (Primavilla et al., 2023). ACV is a fermented product that is categorized as a functional food because of its constituents and nutrients, including vitamins and minerals, as well as its ability to improve its production characteristics and have an inhibitory impact on a variety of bacteria by stopping the movement of nutrients via their cell membrane (Nady et al., 2024). The finding of this research displayed that ACV showed significant inhibitory effects against B. cereus at varying concentrations, as evidenced by the inhibition zone diameter determined by the agar well diffusion test. The zone diameter was between 11.5±0.6 and 16.4±0.3 mm (10% ACV), 13.6±0.4 and 19.4±0.8 mm (30% ACV), 17.2±0.2 and 24.7±0.5 mm (70% ACV), and 19.8±0.6 and 31.6±0.8 mm (100% ACV). Herein, with MIC ranging from 0.14 to 1.25 mg/mL, the MIC data revealed that ACV showed high antibacterial activity against the investigated isolates. Considering the ACV to be a bacteriocidal agent, some of the isolates under examination displayed MBC values at the same MIC value. These results matched those of earlier investigations by Gaber et al. (2020), Mahmoud et al. (2024), and Yagnik et al. (2021). The present findings are indicative of the efficacy of ACV as a natural preservative, as it holds a variety of active components, including antibacterial antagonists, as well as organic acids like malic acid, acetic acid, and phenolic mixtures like cresols, phenol, and ketone constituents (Nady et al., 2024). Organic acids work to stop bacteria from growing in several ways, such as by destroying the bacteria’s outer membrane, consuming the energy of the microbes, and increasing osmotic pressure, which breaks down the cell membrane and encourages the manufacture of antibacterial peptides in the host cells. This force the host cells to discharge many vital nutrients, like glutamic and acid ions, to equilibrate the osmotic pressure inside the cells, which stops bacteria from growing normally (Al-Hadidy et al., 2023). Minimizing the application of extra ingredients in organic manufacturing is often a substantial technological challenge, but it is being promoted by the usage of ACV in organic meat handling.

 Conclusion

According to this investigation, the presence of MDR B. cereus that harbored one or more enterotoxin genes in meat products poses a significant threat to public health. As a result, stricter sanitation regulations must be implemented at all production, handling, and storage stages. Furthermore, employing ACV as a natural antibacterial agent may be a useful way to reduce the risk of B. cereus illness and its occurrence in the food sector, whether in public places or at home, suggesting that it could be a useful natural substitute for traditional preservatives. Future research must assess potential uses in food production for a sustainable strategy to safeguard the health of customers. Testing these substances against bacteria resistant to several drugs is crucial for developing several approaches to handle the rising issue of drug resistance. Furthermore, ACV derivatives can be used as preservatives in several industries, including healthcare (e.g., cosmetics and medications).

 Ethics statement

The Scientific Research Ethics Committee, Aswan University, Faculty of Veterinary Medicine (Approval No.: 15-02-2023) approved all the tests and procedures.

 Acknowledgement

The authors gratefully acknowledge Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2025R457), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. The authors extend their appreciation to the deanship of Scientific Research at King Khalid University for supporting this work under the large group grant (No. R.G.P. 2/8/45).

 Data availability statement

The entire data have been offered in the publication

 Authors contributions

Nady Elbarbary, Mohamed Dandrawy, and Maha Abdelhaseib were in charge of conceptualization, data curation, validation, and methodology. Nasreddin Rhouma and Mostafa Abdelhafeez did formal analysis and investigation. Mounir Bekhit, Ahmed Ezzat, and Wageh Darwish were responsible for investigation, visualization, and supervision. Nady Elbarbary, Layla Al mutairi, Sohaila El-Hawary, and Amin Al-Doaiss were responsible for writing – original draft, revision, and editing of the paper. The authors shared evenly and approved the whole manuscript.

 Conflicts of Interest

The authors’ interests do not conflict with one another.

 Funding

This work was funded by Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2025R457), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia

 Abd El Tawab A.A., Maarouf A.A., El-Hofy F.I., El-Said A.A. 2015. Bacteriological studies on some foodborne bacteria isolated from chicken meat and meat products in Kaliobia Governorate. BVMJ. 29(2): 47–59. 10.21608/bvmj.2015.31545 Algammal A.M., Eid H.M., Alghamdi S., Ghabban H., Alatawy R., Almanzalawi E.A., Alqahtani T.M., Elfouly S.G., Mohammed G.M., Hetta H.F., El-Tarabili R.M. 2024. Meat and meat products as potential sources of emerging MDR Bacillus cereus: groEL gene sequencing, toxigenic and antimicrobial resistance. BMC Microbial. 24(1): 50. 10.1186/s12866-024-03204-9 Al-Hadidy Y., Oleiwi S., Khalaf A., Saleh H. 2023. The effectiveness of adding apple cider vinegar and garlic to chicken meat kebabs as an antimicrobial and its role in improving its sensory and physiochemical properties. Kirkuk. Univ. J. Agricul. Sci. 14(1): 117–130. Amin H.M., and Tawfick M.M. 2021. High risk of potential diarrheagenic Bacillus cereus in diverse food products in Egypt. J. Food Prot. 84(6): 1033–1039. 10.4315/jfp-20-384 Andrews J.M. 2001. Determination of minimum inhibitory concentrations. JAC. 48(suppl_1): 5–16. 10.1093/jac/48.suppl_1.5 Balouiri M., Sadiki M., Ibnsouda S.K. 2016. Methods for in vitro evaluating antimicrobial activity: A review. J. Pharm. Anal. 6: 71–79. 10.1016/j.jpha.2015.11.005 Bashir M., Malik M.A., Moien J.M., Badroo G.A., Bhat A.M., Singh M. 2017. Prevalence and characterization of Bacillus cereus in meat and meat products in and around Jammu region of Jammu and Kashmir, India. Int. J. Curr. Microbiol. App. Sci. 6(12): 1094–1106. 10.20546/IJCMAS.2017.612.124 Berthold-Pluta A., Pluta A., Garbowska M., Stefańska I. 2019. Prevalence and toxicity characterization of Bacillus cereus in food products from Poland. Foods. 8(7): 269. 10.3390/foods8070269 Bhunia A.K. 2018. Foodborne microbial pathogens: Mechanisms and pathogenesis. New York, NY. Springer. 10.1007/978-1-4939-7349-1 Bondoc I. 2016a. European Regulation in the Veterinary Sanitary and Food Safety Area, a Component of the European Policies on the Safety of Food Products and the Protection of Consumer Interests: A 2007 Retrospective. Part One: the Role of European Institutions in Laying Down and Passing Laws Specific to the Veterinary Sanitary and Food Safety Area. Universul Juridic, Supliment, pp. 12–15. Bondoc I. 2016b. European Regulation in the Veterinary Sanitary and Food Safety Area, a Component of the European Policies on the Safety of Food Products and the Protection of Consumer Interests: A 2007 Retrospective. Part Two: Regulations. Universul Juridic, Supliment, pp. 16–19. Centre for Food Safety. 2014. Microbiological Guidelines for Food (For Ready-to-Eat Food in General and Specific Food Items). Hong Kong: Centre for Food Safety/Food and Environmental Hygiene Department. https://www.cfs.gov.hk/english/food_leg/files/food_leg_Microbiological_Guidelines_for_Food_e.pdf CLSI. 2012. Clinical and Laboratory Standards Institute. Reference method for dilution antimicrobial susceptibility tests. Approved standard M7-A6 (CLSI). National Committee for Clinical Laboratory Standards, Wayne, PA, USA. CLSI. 2017. Bacillus. In: Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing: 27th Ed 424 Informational Supplement. CLSI; 2017. CLSI Doc. M100-S20 (2017). Wayne, PA, USA. Ehling-Schulz M., Frenzel E., Gohar M. 2015. Food-bacteria interplay: Pathometabolism of emetic Bacillus cereus. Front. Microbiol. 6: 704. 10.3389/fmicb.2015.00704 Ehling-Schulz M., Vukov N., Schulz A., Shaheen R., Andersson M., Martlbauer E., Scherer S. 2005. Identification and partial characterization of the nonribosomal peptide synthetase gene responsible for cereulide production in emetic Bacillus cereus. Appl. Environ. Microbiol. 71: 105–113. 10.1128/aem.71.1.105-113.2005 Elbarbary N., Dandrawy M.K., Hadad G., Abdelhaseib M., Amna A., Alenazy R., Elbagory I., Abdelmotilib N.M., Elnoamany F., Ibrahim G.A., Gomaa R.A. 2024. Bacterial quality and molecular detection of food poisoning virulence genes isolated from Nasser Lake Fish, Aswan, Egypt. Int. J. Food Sci. 6095430: 12. 10.1155/2024/6095430 El-Hawary S.F., Ali M.A., Mounir M.B., Ehab I.T., Abdelhaseib M., Abdelmotilib M., Mohamed M., Nady Kh.E. 2025. Tackling food spoilage bacteria: How pomegranate peel extract can improve beef safety. Italian J. Food Sci. 37: (2). 10.15586/ijfs.v37i2.2945 ECDC. 2019. European Centre for Disease Prevention and Control. The European Union one health 2018 zoonoses report. EFSA J. 17(12): e05926. Foxcroft N., Masaka E., Oosthuizen J. 2024. Prevalence trends of foodborne pathogens Bacillus cereus, non-STEC Escherichia coli and Staphylococcus aureus in ready-to-eat foods sourced from restaurants, cafés, catering and takeaway food premises. Int. J. Environ. Res. Public Health. 21: 1426. 10.3390/ijerph21111426 FSANZ. 2001. Food Standards Australia New Zealand. Microbiological quality guide for ready-to-eat foods. A guide to interpreting microbiological results; 2001. Fraccalvieri R., Bianco A., Difato L.M., Capozzi L., Del Sambro L., Simone D., Catanzariti R., Caruso M., Galante D., Normanno G., Palazzo L., Tempesta M., Parisi A. 2022. Toxigenic genes, pathogenic potential and antimicrobial resistance of Bacillus cereus group isolated from ice cream and characterized by whole genome sequencing. Foods. 11(16): 2480. 10.3390/foods11162480 Friedman N.D., Temkin E., Carmeli Y. 2016. The negative impact of antibiotic resistance. Clin. Microbiol. Infect. 22: 416–422. 10.1016/j.cmi.2015.12.002 Gaber S.N., Bassyouni R.H., Masoud M., Ahmed F.A. 2020. Promising anti-microbial effect of apple vinegar as a natural decolonizing agent in healthcare workers. Alexandria J. Med. 56(1): 73–80. 10.1080/20905068.2020.1769391 Gao T., Ding Y., Wu Q., Wang J., Zhang J., Yu S., Yu P., Liu C., Kong L., Feng Z., Chen M., Wu S., Zeng H., Wu H. 2018. Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of bacillus cereus isolated from pasteurized milk in China. Front. Microbiol. 9: 533. 10.3389/fmicb.2018.00533 Giffel M.C., Beumer M.C., Slaghuis R.R., Rombouts F.M. 1996. Occurrence and characterization of (psychrostrophic) B. cereus on farms in the Netherlands. Neth. Milk Dairy J. 49: 125–238. Hansen B.M., and Hendriksen N.B. 2001. Detection of enterotoxic Bacillus cereus and Bacillus thuringiensis strains by PCR analysis. Appl. Environ. Microbiol. 67: 185–189. 10.1128/aem.67.1.185-189.2001 Hassan M., Amin R., Eleiwa N., Hussien F. 2019. Antimicrobial effect of nisin on Bacillus cereus isolated from some meat products. Benha Vet. Med. J. 37(1): 77–80. 10.21608/bvmj.2019.18087.1113 Health Protection Agency. 2009. Guidelines for assessing the microbiological safety of ready-to-eat foods placed on the market. In: Health Protection Agency London; 2009. Hwang J.Y., and Park J.H. 2015. Characteristics of enterotoxin distribution, hemolysis, lecithinase, and starch hydrolysis of Bacillus cereus isolated from infant formulas and ready-to-eat foods. J. Dairy Sci. 98(3): 1652–60. 10.3168/jds.2014-9042 Ikeda M., Yagihara Y., Tatsuno K., Okazaki M., Okugawa S., Moriya K. 2015. Clinical characteristics and antimicrobial susceptibility of Bacillus cereus blood stream infections. Ann. Clin. Microbiol. Antimicrob. 14: 43. 10.1186/s12941-015-0104-2 ISO, 21871. 2006. Standard microbiology of food and feeding stuffs. Horizontal method for the determination of low numbers of presumptive Bacillus cereus. Geneva, Switzerland: International Organization for Standardization, ISO—Bacillus cereus, p. 14. Khairy E.N., Al-Qaaneh A.M., Mounir M.B., Abdelhaseib M., Reda A.G., Ali M.A., Salem M.M., Malak N.M. 2024. Citrus reticulata flavonoids as a valuable source for reducing meat-borne Aeromonas hydrophila. Italian J. Food Sci. 36(3): 263–273. 10.15586/ijfs.v36i3.2606 Lozano C., López M., Rojo-Bezares B., Sáenz Y. 2020. Antimicrobial susceptibility testing in Pseudomonas aeruginosa biofilms: One step closer to a standardized method. Antibiotics (Basel). 9: 880. 10.3390/antibiotics9120880 Magiorakos A.P., Srinivasan A., Carey R.B., Carmeli Y., Falagas M., Giske C., Harbarth S., Hindler J.F., Kahlmeter G., Olsson-Liljequist B., Paterson D.L., Rice L.B., Stelling J., Struelens M.J., Vatopoulos A., Weber J.T., Monnet D.L. 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18(3): 268–81. 10.1111/j.1469-0691.2011.03570.x Mahmoud R.M., Gharib A.A., Abd El-Aziz N.K., Ali E.M., Mokhtar A., Ibrahim G.A., Ammar A.M. 2024. Apple cider vinegar exhibits promising antibiofilm activity against multidrug-resistant Bacillus cereus isolated from meat and their products. Open Vet. J. 14(1): 186–199. 10.5455/OVJ.2024.v14.i1.17 Mostafa N.F., Elkenany R.M., Younis G. 2022. Characterization of Bacillus cereus isolated from contaminated foods with sequencing of virulence genes in Egypt. Braz. J. Biol. 84: e257516. 10.1590/1519-6984.257516 Nady K., Abdelmotilib N.M., Salem-Bekhit M.M., Salem M.M., Singh S., Dandrawy M.K. 2024. Antibacterial efficiency of apple vinegar marination on beef-borne Salmonella. Open Vet. J. 14(1): 274–283. 10.5455/OVJ.2024.v14.i1.24 Owusu-Kwarteng J., Wuni A., Akabanda F., Tano-Debrah K., Jespersen L. 2017. Prevalence, virulence factor genes and antibiotic resistance of Bacillus cereus sensu lato isolated from dairy farms and traditional dairy products. BMC Microbiol. 17(1): 1–8. 10.1186/s12866-017-0975-9 Primavilla S., Pagano C., Roila R., Branciari R., Ranucci D., Valiani A., Ricci M., Perioli L. 2023. Antibacterial activity of Crocus sativus L. petals extracts against foodborne pathogenic and spoilage microorganisms, with a special focus on Clostridia. Life. 13: 60. 10.3390/life13010060 Qenawy E.M., Abou-Ellail M., Abdel-Motaal F., Alshaharni M.O., Elbarbary N.K. 2024. Prevalence of Pseudomonas aeruginosa, Escherichia coli, and their virulence genes in adulterated meat products. Adv. Anim. Vet. Sci. 12: 139–149. 10.17582/journal.aavs/2024/12.s1.139.149 Quinn P.J., Markey B.K., Carter M.E., Donnelly W.J., Leonard F.C., Meguire D. 2002. Veterinary microbiology and microbial disease, 2nd ed. Blackwell Science, Iowa State University Press, Ames, Iowa, USA, pp: 84–96. Savić D., Miljković-Selimović B., Lepšanović Z., Tambur Z., Konstantinović S., Stanković N., Ristanović E. 2016. Antimicrobial susceptibility and β-lactamase production in Bacillus cereus isolates from stool of patients, food and environment samples. Vojnosanit Pregl. 73(10): 904–9. 10.2298/VSP150415134S Shawish R.R., and Al-Humam N.A. 2016. Contamination of beef products with staphylococcal classical enterotoxins in Egypt and Saudi Arabia. GMS HIC. 11: Doc08. 10.3205/dgkh000268 Shawish R., and Tarabees R. 2017. Prevalence and antimicrobial resistance of Bacillus cereus isolated from beef products in Egypt. Open Vet. J. 7(4): 337–341. 10.4314/ovj.v7i4.9 Song Z., Zhao Q., Zhu L., Zhang Z., Jiang L., Huang H. 2019. Draft genome sequence of multidrug-resistant b-lactamase-producing Bacillus cereus S66 isolated from China. J. Glob. Antimicrob. Resist. 17: 23–24. 10.1016/j.jgar.2019.02.019 Stenfors Arnesen L.P., Fagerlund A., Granum P.E. 2008. From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev. 32(4): 579–606. 10.1111/j.1574-6976.2008.00112.x Tallent S.M., Kotewicz K.M., Strain E.A., Bennett R.W. 2012. Efficient isolation and identification of Bacillus cereus group. J. AOAC Int. 95(2): 446–451. 10.5740/jaoacint.11-251 Tewari A., Singh S.P., Singh R. 2015. Incidence and enterotoxigenic profile of Bacillus cereus in meat and meat products of Uttarakhand, India. J. Food Sci. Technol. 52(3): 1796–801. 10.1007/s13197-013-1162-0 Tirloni E., Stella S., Celandroni F., Mazzantini D., Bernardi C., Ghelardi E. 2022. Bacillus cereus in dairy products and production plants. Foods. 11: 2572. 10.3390/foods11172572 Tropea A. 2022. Microbial contamination and public health: An overview. Int. J. Environ. Res. Public. Health. 19: 7441. 10.3390/ijerph19127441 Yagnik D., Ward M., Shah A.J. 2021. Antibacterial apple cider vinegar eradicates methicillin resistant Staphylococcus aureus and resistant Escherichia coli. Sci. Rep. 11(1): 17. 10.1038/s41598-020-78407-x Yu S., Yu P., Wang J., Li C., Guo H., Liu C., Kong L., Yu L., Wu S., Lei T., Chen M., Zeng H., Pang R., Zhang Y., Wei X., Zhang J., Wu Q., Ding Y. 2020. A study on prevalence and characterization of Bacillus cereus in ready-to-eat foods in China. Front. Microbiol. 10: 3043. 10.3389/fmicb.2019.03043